HBR Program Description

HBR - Recognition of Human and E.coli sequences to test a library for E. coli contamination

Department of Cell Biology, Baylor College of Medicine


Analysis of uncharacterized human sequences is available through WWW MOSAIC or by sending your file containing a sequence (a sequence name is in the first string) to

service@bchs.uh.edu with the subject line "hbr".

Examples: mail -s hbr service@bchs.uh.edu < test.seq

mail -s hbr services@bioinformatics.weizmann.ac.il < test.seq

where test.seq a file with the sequence.

Description:
Recognition of human and bacterial sequences (HBR) to test a library for E. coli contamination by sequencing example clones. The program calculates the probability to be a human sequence (P) or E.coli sequence (1-P) for each sequence of your set and the total percentage human and bacterial sequences in the set.

Accuracy:
The accuracy of recognition is about 99%. But you have better to present long sequences and enough representative set of them.

We recommend to analyse 400 bp and longer sequences and do not take into account the sequences with 0.4 < P < 0.6 which can not be reliable assigned to human or E.coli group.

Submitting sequences: For Email submission the sequences must have the following format: (for WWW put the line with the Name of your 1st sequence to Sequence name box)

 Name of your 1st  sequence
ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca
ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag
aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac
ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat
  Name of the 2nd  sequence
atcttcttctccccagtgagcatcg...............

(Restrict the line length to less than 80 characters; The line with the sequence name must have at least one 'Space' symbol in the first position).

HBR output:

For example:
  Number of sequences-     12 % human=  50 % bacterial=  50
     1     2     3     4     5     6     7     8     9    10
   900   960  1501   360   360  1020   330   480   240   541
  1.00  1.00  0.83  1.00  1.00  0.00  0.01  0.01  0.00  0.01
    11    12
   720   540
  0.57  0.01


Back to BCM Gene Finder Home Page

Victor V.Solovyev, Department of Cell Biology, Baylor College of Medicine
solovyev@cmb.bcm.tmc.edu
Last modified: 4.25.1995