RNASPL Program Description

RNASPL - Prediction of exon-exon junction positions in cDNA sequences

Department of Cell Biology, Baylor College of Medicine

Analysis of uncharacterized human sequences is available through WWW MOSAIC or by sending your file containing a sequence (a sequence name is in the first string) to

service@bchs.uh.edu with the subject line "rnaspl".

Examples: mail -s rnaspl service@bchs.uh.edu < test.seq

mail -s rnaspl services@bioinformatics.weizmann.ac.il < test.seq

where test.seq a file with the sequence.

Description:

Recognition of exon-exon junctions in cDNA may be very useful for gene sequencing when starting with a sequence of cDNA clone. In a given cDNA sequence we need to select sites for PCR primers that (hopefully) lie in adjacent exons. Prediction is performed by linear discriminant function combining characteristics describing tipical sequences around exon-exon junctions.

• Reference:
  • Solovyev V.V.,Salamov A.A., Lawrence C.B. Predicting internal exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames. (Nucl.Acids Res.,1994,22,24,5156-5163).

Accuracy:

We can not predict exon-exon junction position with very high accuracy, because some information was lost after splicing. We predict positions marked by '*', where 75% of potential exon-exon junctions are localized. Additionally, we mark '-' positions where exon-exon junctions absent with probability about 90%.

We recommend to select primer sequences in continuous '-' regions, that do not cross '*' or ' ' positions.

SEE ALSO "fgeneh" (prediction of gene structure), "fexh" (5',internal and 3'-coding exon prediction) and "hspl" (splice site prediction) programs from the BCM Gene Finder.

Submitting sequences via email:

For email submission the sequences must have the following format:

Name of your sequence

ccatctctgtcttgcaggacaatgccgtcttctgtctcgtggggcatcctcctgctggca

ggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccag

aagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaac

ctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaat

atcttcttctccccagtgagcatcg...............

(The line length must be less than 80 letters).

RNASPL output:

• 1st line - name of your sequence
• 2nd line - your sequence
• 3d line - '*' shows potential exon-exon junction position (Pr > 0.75) '-' shows position where exon-exon junction absent (Pr > 0.90) 'n' is nonanalyzed flanking position

   HSACHG7       690 bp    DNA             PRI       18-DEC-1990                        10        20        30        40        50        60
ATGGCGGCGACGGCGAGTGCCGGGGCCGGCGGGATGGACGGGAAGCCCCGTACCTCCCCT
nnnnnnnnnnnnnnnnnnnn--------  ---------*---- ----*----------
        70        80        90       100       110       120
AAGTCCGTCAAGTTCCTGTTTGGGGGCCTGGCCGGGATGGGAGCTACAGTTTTTGTCCAG
----- *----*--------- -- --------*-------  --------------- -
       130       140       150       160       170       180
CCCCTGGACCTGGTGAAGAACCGGATGCAGTTGAGCGGGGAAGGGGCCAAGACTCGAGAG
-----------*-*--- ---- ------ --*----- -----------*------ --
       190       200       210       220       230       240
TACAAAACCAGCTTCCATGCCCTCACCAGTATCCTGAAGGCAGAAGGCCTGAGGGGCATT
------ ---------- ----------------  ------------------------
       250       260       270       280       290       300
TACACTGGGCTGTCGGCTGGCCTGCTGCGTCAGGCCACCTACACCACTACCCGCCTTGGC
----- -- ------------------------------------------------ --

Victor V.Solovyev, Department of Cell Biology, Baylor College of Medicine
solovyev@cmb.bcm.tmc.edu
Last modified: 2.2.1995