Content-type: text/html Content-type: text/html NCBI BLAST Search Results
 

BLASTN Search Results with RepeatMasker filtering, Entrez and SRS links

BLAST search performed using the National Center for Biotechnology Information's BLAST WWW Server. Repeat reporting and filtering performed by RepeatMasker from U. Washington.

Links to Entrez and to the Sequence Retrieval System (SRS) provided by the Human Genome Sequencing Center, Baylor College of Medicine:

to_Entrez = Retrieve Entrez links (e.g., Medline abstracts, FASTA-formatted sequence reports).
to_Related = Retrieve Entrez links to Related sequences (neighbors).
to_SRS = Retrieve SRS links (if present).

Repeat sequence:

   SW  perc perc perc  query     position in query    matching     repeat       position in  repeat
score  div. del. ins.  sequence  begin  end (left)    repeat       class/family begin  end (left)

  229  26.8  0.0  0.0  ECOPGSA     789  844  (112) +  tRNA-Lys-AAG tRNA             8   63   (13)  

Alignments:

 229 26.79 0.00 0.00  ECOPGSA      789   844 (112)    tRNA-Lys-AAG#tRNA        8    63 (13)  

  ECOPGSA            789 TAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGCGAGTTCG 838
                                  i         i  vvi vii  vv  i      i i     
  tRNA-Lys-AAG#tR      8 TAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGGGTCGTGGGTTCG 57

  ECOPGSA            839 AGTCTC 844
                           i i 
  tRNA-Lys-AAG#tR     58 AGCCCC 63

Transitions / transversions = 2.00 (10 / 5)
Gap_init rate = 0.00 (0 / 56), avg. gap size = 0.00 (0 / 0)  

Masked Sequence:

>ECOPGSA
GATCTTCTGGTCGTTGAAACATTGATGTCTCTGTAGCAACATAGGGGTAA
TCTTACTGACAACAGATAGTTACCCGTCATTATGCAATTTAATATCCCTA
CGTTGCTTACACTGTTCCGTGTCATCCTTATCCCATTCTTTGTATTGGTC
TTTTATCTGCCTGTCACCTGGTCGCCGTTTGCCGCCGCGCTCATTTTCTG
CGTCGCGGCGGTGACTGACTGGTTCGATGGTTTTCTGGCACGCCGCTGGA
ACCAGAGTACCCGGTTTGGTGCTTTCCTTGACCCTGTGGCAGATAAAGTT
CTCGTGGCTATCGCCATGGTGCTGGTAACCGAGCATTATCACAGCTGGTG
GGTGACATTACCGGCGGCAACGATGATCGCCCGTGAAATTATTATTTCTG
CGCTACGCGAATGGATGGCGGAGTTGGGTAAACGCAGTAGCGTGGCCGTC
TCCTGGATTGGGAAAGTGAAAACCACTGCCCAGATGGTGGCGTTGGCATG
GCTGCTGTGGCGTCCGAACATTTGGGTTGAGTACGCCGGTATTGCACTTT
TCTTTGTGGCTGCGGTACTGACTCTGTGGTCAATGTTGCAATATTTGAGC
GCTGCGCGTGCAGATTTGCTTGATCAGTGATCGTTTCGGCGTAATTTTCA
GCAAACGATCAAAAGTGGTGAAAAATATCGTTGACTCATCGCGCCAGGTA
AGTAGAATGCAACGCATCGAACGGCGGCACTGATTGCCAGACGATAATAA
AATCAAGTGATTAACTGATTGCTTGATGAATGCGGGAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTCC
CGCTCCAGTTTAAAAGACATCGGCGTCAAGCGGATGTCTGGCTGAAAGGC
CTGAAGAATTTGGCGCGTTAACAAAGCGGTTATGTAGCGGATTGCAAATC
CGTCTA

Summary:

==================================================
file name: /repeatmasker/tmp/RM2seq
sequences:          1
total length:     956 bp
GC level:       49.90 %
bases masked       56 bp (  5.86 %)
==================================================
               number of      length   percentage
               elements*    occupied  of sequence
--------------------------------------------------
SINEs:               0           0 bp     0.00 %
      ALUs           0           0 bp     0.00 %
      MIRs           0           0 bp     0.00 %

LINEs:               0           0 bp     0.00 %
      LINE1          0           0 bp     0.00 %
      LINE2          0           0 bp     0.00 %

LTR elements:        0           0 bp     0.00 %
      MaLRs          0           0 bp     0.00 %
      Retrov.        0           0 bp     0.00 %
      MER4_group     0           0 bp     0.00 %

DNA elements:        0           0 bp     0.00 %
      MER1_type      0           0 bp     0.00 %
      MER2_type      0           0 bp     0.00 %
      Mariners       0           0 bp     0.00 %

Unclassified:        0           0 bp     0.00 %

Total interspersed repeats:      0 bp     0.00 %


Small RNA:           1          56 bp     5.86 %

Satellites:          0           0 bp     0.00 %
Simple repeats:      0           0 bp     0.00 %
Low complexity:      0           0 bp     0.00 %
==================================================

* most repeats fragmented by insertions or deletions
  have been counted as one element

The sequence(s) were assumed to be of primate origin.
RepeatMasker version  05/05/99               default
ProcessRepeats version  05/05/99
Repbase version 3.04
.
BCM HGSC



Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= ECOPGSA
         (956 letters)

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs

Distribution of 5 Blast Hits on the Query Sequence



                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|4631764|dbj|AU047129.1|AU047129  Rattus norvegicus, OTSUK...    38  0.083
gi|5223770|gb|G52593.1|G52593  SHGC-81577 Human Homo sapiens...    36  0.33
gi|308704|gb|L16352|HUMUT904  Human chromosome 8 STS UT904.        34  1.3
gi|720650|gb|G03692|G03692  human STS WI-183.                      34  1.3
gi|4492213|gb|G45922.1|G45922  Z5031_1 Zebrafish AB Danio re...    34  1.3

to_Entrezto_Relatedto_SRS gi|4631764|dbj|AU047129.1|AU047129 Rattus norvegicus, OTSUKA clone, 139g03, microsatellite sequence,
           sequence tagged site
           Length = 501
           
 Score = 38.2 bits (19), Expect = 0.083
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 260 cccggtttggtgctttcct 278
           |||||||||||||||||||
Sbjct: 153 cccggtttggtgctttcct 135


to_Entrezto_Relatedto_SRS gi|5223770|gb|G52593.1|G52593 SHGC-81577 Human Homo sapiens STS genomic, sequence tagged site
           Length = 509
           
 Score = 36.2 bits (18), Expect = 0.33
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 888 ctggctgaaaggcctgaa 905
           ||||||||||||||||||
Sbjct: 200 ctggctgaaaggcctgaa 183


to_Entrezto_Relatedto_SRS gi|308704|gb|L16352|HUMUT904 Human chromosome 8 STS UT904.
           Length = 419
           
 Score = 34.2 bits (17), Expect = 1.3
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 213 gactgactggttcgatggttt 233
           |||||||||||| ||||||||
Sbjct: 248 gactgactggttggatggttt 268


to_Entrezto_Relatedto_SRS gi|720650|gb|G03692|G03692 human STS WI-183.
           Length = 138
           
 Score = 34.2 bits (17), Expect = 1.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 659 tcaaaagtggtgaaaaa 675
           |||||||||||||||||
Sbjct: 55  tcaaaagtggtgaaaaa 71


to_Entrezto_Relatedto_SRS gi|4492213|gb|G45922.1|G45922 Z5031_1 Zebrafish AB Danio rerio STS genomic clone Z5031 5',
           sequence tagged site
           Length = 448
           
 Score = 34.2 bits (17), Expect = 1.3
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 345 ctggtgggtgacattac 361
           |||||||||||||||||
Sbjct: 234 ctggtgggtgacattac 250


CPU time:     0.08 user secs.	    0.02 sys. secs	    0.10 total secs.

  Database: Non-redundant Database of GenBank STS Division
    Posted date:  Oct 8, 1999  6:16 PM
  Number of letters in database: 28,665,134
  Number of sequences in database:  80,777
  
Lambda     K      H
    1.37    0.711     0.00 

Gapped
Lambda     K      H
    1.37    0.711 4.94e-324 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 9785
Number of Sequences: 80777
Number of extensions: 9785
Number of successful extensions: 640
Number of sequences better than 10.0: 5
length of query: 956
length of database: 28,665,134
effective HSP length: 18
effective length of query: 938
effective length of database: 27,211,148
effective search space: 25524056824
effective search space used: 25524056824
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)