NCBI BLAST Search Results

BLASTN Search Results with RepeatMasker filtering, Entrez and SRS links

BLAST search performed using the National Center for Biotechnology Information's BLAST WWW Server. Repeat reporting and filtering performed by RepeatMasker from U. Washington.

Links to Entrez and to the Sequence Retrieval System (SRS) provided by the Human Genome Sequencing Center, Baylor College of Medicine:

= Retrieve Entrez links (e.g., Medline abstracts, FASTA-formatted sequence reports).

= Retrieve Entrez links to Related sequences (neighbors).

= Retrieve SRS links (if present).



Repeat sequence:
   SW  perc perc perc  query     position in query    matching     repeat       position in  repeat
score  div. del. ins.  sequence  begin  end (left)    repeat       class/family begin  end (left)

  229  26.8  0.0  0.0  ECOPGSA     789  844  (112) +  tRNA-Lys-AAG tRNA             8   63   (13)  

Alignments:
 229 26.79 0.00 0.00  ECOPGSA      789   844 (112)    tRNA-Lys-AAG#tRNA        8    63 (13)  

  ECOPGSA            789 TAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGCGAGTTCG 838
                                  i         i  vvi vii  vv  i      i i     
  tRNA-Lys-AAG#tR      8 TAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGGGTCGTGGGTTCG 57

  ECOPGSA            839 AGTCTC 844
                           i i 
  tRNA-Lys-AAG#tR     58 AGCCCC 63

Transitions / transversions = 2.00 (10 / 5)
Gap_init rate = 0.00 (0 / 56), avg. gap size = 0.00 (0 / 0)  

Masked Sequence:
>ECOPGSA
GATCTTCTGGTCGTTGAAACATTGATGTCTCTGTAGCAACATAGGGGTAA
TCTTACTGACAACAGATAGTTACCCGTCATTATGCAATTTAATATCCCTA
CGTTGCTTACACTGTTCCGTGTCATCCTTATCCCATTCTTTGTATTGGTC
TTTTATCTGCCTGTCACCTGGTCGCCGTTTGCCGCCGCGCTCATTTTCTG
CGTCGCGGCGGTGACTGACTGGTTCGATGGTTTTCTGGCACGCCGCTGGA
ACCAGAGTACCCGGTTTGGTGCTTTCCTTGACCCTGTGGCAGATAAAGTT
CTCGTGGCTATCGCCATGGTGCTGGTAACCGAGCATTATCACAGCTGGTG
GGTGACATTACCGGCGGCAACGATGATCGCCCGTGAAATTATTATTTCTG
CGCTACGCGAATGGATGGCGGAGTTGGGTAAACGCAGTAGCGTGGCCGTC
TCCTGGATTGGGAAAGTGAAAACCACTGCCCAGATGGTGGCGTTGGCATG
GCTGCTGTGGCGTCCGAACATTTGGGTTGAGTACGCCGGTATTGCACTTT
TCTTTGTGGCTGCGGTACTGACTCTGTGGTCAATGTTGCAATATTTGAGC
GCTGCGCGTGCAGATTTGCTTGATCAGTGATCGTTTCGGCGTAATTTTCA
GCAAACGATCAAAAGTGGTGAAAAATATCGTTGACTCATCGCGCCAGGTA
AGTAGAATGCAACGCATCGAACGGCGGCACTGATTGCCAGACGATAATAA
AATCAAGTGATTAACTGATTGCTTGATGAATGCGGGAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTCC
CGCTCCAGTTTAAAAGACATCGGCGTCAAGCGGATGTCTGGCTGAAAGGC
CTGAAGAATTTGGCGCGTTAACAAAGCGGTTATGTAGCGGATTGCAAATC
CGTCTA

Summary:
==================================================
file name: /repeatmasker/tmp/RM2seq
sequences:          1
total length:     956 bp
GC level:       49.90 %
bases masked       56 bp (  5.86 %)
==================================================
               number of      length   percentage
               elements*     occupied  of sequence
--------------------------------------------------
SINEs:               0           0 bp     0.00 %
      B1s            0           0 bp     0.00 %
      B2-B4          0           0 bp     0.00 %
      IDs            0           0 bp     0.00 %
      MIRs           0           0 bp     0.00 %

LINEs:               0           0 bp     0.00 %
      LINE1          0           0 bp     0.00 %
      LINE2          0           0 bp     0.00 %

LTR elements:        0           0 bp     0.00 %
      MaLRs          0           0 bp     0.00 %
      Retroviral     0           0 bp     0.00 %
      MER4_group     0           0 bp     0.00 %

DNA elements:        0           0 bp     0.00 %
      MER1_type      0           0 bp     0.00 %
      MER2_type      0           0 bp     0.00 %
      Mariners       0           0 bp     0.00 %

Unclassified:        0           0 bp     0.00 %

Total interspersed repeats:      0 bp     0.00 %


Small RNA:           1          56 bp     5.86 %

Satellites:          0           0 bp     0.00 %
Simple repeats:      0           0 bp     0.00 %
Low complexity:      0           0 bp     0.00 %
==================================================

* most repeats fragmented by insertions or deletions
  have been counted as one element

The sequence(s) were assumed to be of rodent origin.
RepeatMasker version  05/05/99               default
ProcessRepeats version  05/05/99
Repbase version 3.04


  

   
    
  
   
     
     
        
HGSC 
|SL Home
|Search 
Tools 
|Help 
|FAQ 
|What's 
New 
|Contact 
Us  
|Comments	
|User 
Survey 
    
  
   
    
  
   
     
      
         
            
          
           
             
              This document last modified 19 Aug 2003

               This document's location: http://searchlauncher.bcm.tmc.edu/seq-search/Examples/blastn_mouse.html

Contact Us

Use of this web site is subject to the disclaimer

Copyright© Baylor College of Medicine

Human Genome Sequencing Center, One Baylor Plaza, Houston, TX

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= ECOPGSA (956 letters)

If you have any problems or questions with the results of this search
please refer to the BLAST FAQs

Distribution of 17 Blast Hits on the Query Sequence


                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

gi|1889521|gb|AA254935|AA254935  mz80h09.r1 Soares mouse NML...    36  3.0
gi|5337511|gb|AI789795.1|AI789795  ui53h11.x1 Sugano mouse l...    36  3.0
gi|4604762|gb|AI595714.1|AI595714  uj68e04.x1 Sugano mouse l...    36  3.0
gi|3749469|gb|AI196863|AI196863  ui67f12.x1 Sugano mouse liv...    36  3.0
gi|3448879|gb|AI099354|AI099354  ue30a11.x1 Sugano mouse liv...    36  3.0
gi|5334020|gb|AI786304.1|AI786304  uj53d03.x1 Sugano mouse l...    36  3.0
gi|4441202|gb|AI527067|AI527067  uj49c09.x1 Sugano mouse liv...    36  3.0
gi|3719996|gb|AI173854|AI173854  ud72h09.x1 Sugano mouse liv...    36  3.0
gi|4275340|gb|AI429414|AI429414  mn98g04.x1 Stratagene mouse...    36  3.0
gi|3883804|gb|AI265646|AI265646  uj04d04.x1 Sugano mouse liv...    36  3.0
gi|3296117|gb|AI047830|AI047830  ud64b12.x1 Sugano mouse liv...    36  3.0
gi|3719704|gb|AI173562|AI173562  ud68b12.x1 Sugano mouse liv...    36  3.0
gi|1905728|gb|AA268736|AA268736  vb01a10.r1 Soares mouse NML...    36  3.0
gi|5184895|dbj|AV065067.1|AV065067  AV065067 Mus musculus sm...    36  3.0
gi|4764641|gb|AI661058.1|AI661058  mz80h09.x1 Soares mouse N...    36  3.0
gi|3863104|gb|AI255579|AI255579  ui68g02.x1 Sugano mouse liv...    36  3.0
gi|4318818|gb|AI464788|AI464788  mz80h09.y1 Soares mouse NML...    36  3.0

 gi|1889521|gb|AA254935|AA254935 mz80h09.r1 Soares mouse NML Mus musculus cDNA clone 719777 5'
           similar to TR:G563829 G563829 FATTY ACID TRANSPORT
           PROTEIN. ;
           Length = 457
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 337 gttggcatggctgctgtg 354


 gi|5337511|gb|AI789795.1|AI789795 ui53h11.x1 Sugano mouse liver mlia Mus musculus cDNA clone
           IMAGE:1886181 3' similar to TR:O88694 O88694
           VERY-LONG-CHAIN ACYL-COA SYNTHETASE RELATED PROTEIN. ;,
           mRNA sequence
           Length = 726
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 438 gttggcatggctgctgtg 421


 gi|4604762|gb|AI595714.1|AI595714 uj68e04.x1 Sugano mouse liver mlia Mus musculus cDNA clone
           IMAGE:1925118 3' similar to TR:P97524 P97524
           VERY-LONG-CHAIN ACYL-COA SYNTHETASE. ;, mRNA sequence
           Length = 528
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 411 gttggcatggctgctgtg 394


 gi|3749469|gb|AI196863|AI196863 ui67f12.x1 Sugano mouse liver mlia Mus musculus cDNA clone 1887503
           3' similar to TR:P97524 P97524 VERY-LONG-CHAIN ACYL-COA
           SYNTHETASE. ;, mRNA sequence [Mus musculus]
           Length = 579
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 441 gttggcatggctgctgtg 424


 gi|3448879|gb|AI099354|AI099354 ue30a11.x1 Sugano mouse liver mlia Mus musculus cDNA clone 1481852
           3' similar to TR:P97524 P97524 VERY-LONG-CHAIN ACYL-COA
           SYNTHETASE. ;, mRNA sequence [Mus musculus]
           Length = 528
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 429 gttggcatggctgctgtg 412


 gi|5334020|gb|AI786304.1|AI786304 uj53d03.x1 Sugano mouse liver mlia Mus musculus cDNA clone
           IMAGE:1923653 3' similar to TR:O88694 O88694
           VERY-LONG-CHAIN ACYL-COA SYNTHETASE RELATED PROTEIN. ;,
           mRNA sequence
           Length = 611
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 416 gttggcatggctgctgtg 399


 gi|4441202|gb|AI527067|AI527067 uj49c09.x1 Sugano mouse liver mlia Mus musculus cDNA clone
           IMAGE:1923280 3' similar to TR:P97524 P97524
           VERY-LONG-CHAIN ACYL-COA SYNTHETASE. ;, mRNA sequence
           [Mus musculus]
           Length = 547
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 418 gttggcatggctgctgtg 401


 gi|3719996|gb|AI173854|AI173854 ud72h09.x1 Sugano mouse liver mlia Mus musculus cDNA clone 1451489
           3' similar to TR:P97524 P97524 VERY-LONG-CHAIN ACYL-COA
           SYNTHETASE. ;, mRNA sequence [Mus musculus]
           Length = 506
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 434 gttggcatggctgctgtg 417


 gi|4275340|gb|AI429414|AI429414 mn98g04.x1 Stratagene mouse lung 937302 Mus musculus cDNA clone
           IMAGE:552150 3' similar to TR:P97524 P97524
           VERY-LONG-CHAIN ACYL-COA SYNTHETASE. ;, mRNA sequence
           [Mus musculus]
           Length = 525
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 420 gttggcatggctgctgtg 403


 gi|3883804|gb|AI265646|AI265646 uj04d04.x1 Sugano mouse liver mlia Mus musculus cDNA clone
           IMAGE:1890919 3' similar to TR:P97524 P97524
           VERY-LONG-CHAIN ACYL-COA SYNTHETASE. ;, mRNA sequence
           [Mus musculus]
           Length = 570
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 411 gttggcatggctgctgtg 394


 gi|3296117|gb|AI047830|AI047830 ud64b12.x1 Sugano mouse liver mlia Mus musculus cDNA clone 1450655
           3' similar to TR:P97524 P97524 VERY-LONG-CHAIN ACYL-COA
           SYNTHETASE. ;
           Length = 785
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 429 gttggcatggctgctgtg 412


 gi|3719704|gb|AI173562|AI173562 ud68b12.x1 Sugano mouse liver mlia Mus musculus cDNA clone 1451039
           3' similar to TR:P97524 P97524 VERY-LONG-CHAIN ACYL-COA
           SYNTHETASE. ;, mRNA sequence [Mus musculus]
           Length = 700
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 430 gttggcatggctgctgtg 413


 gi|1905728|gb|AA268736|AA268736 vb01a10.r1 Soares mouse NML Mus musculus cDNA clone 747642 5'
           similar to TR:G563829 G563829 FATTY ACID TRANSPORT
           PROTEIN. ;
           Length = 366
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 22  gttggcatggctgctgtg 39


 gi|5184895|dbj|AV065067.1|AV065067 AV065067 Mus musculus small intestine C57BL/6J adult Mus musculus
           cDNA clone 2010013H05, mRNA sequence
           Length = 286
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 449 tctcctggattgggaaagtgaa 470
           ||||||||||| ||||||||||
Sbjct: 8   tctcctggatttggaaagtgaa 29


 gi|4764641|gb|AI661058.1|AI661058 mz80h09.x1 Soares mouse NML Mus musculus cDNA clone IMAGE:719777 3'
           similar to TR:O88694 O88694 VERY-LONG-CHAIN ACYL-COA
           SYNTHETASE RELATED PROTEIN. ;, mRNA sequence
           Length = 460
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 421 gttggcatggctgctgtg 404


 gi|3863104|gb|AI255579|AI255579 ui68g02.x1 Sugano mouse liver mlia Mus musculus cDNA clone
           IMAGE:1887602 3' similar to TR:P97524 P97524
           VERY-LONG-CHAIN ACYL-COA SYNTHETASE. ;, mRNA sequence
           [Mus musculus]
           Length = 578
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 443 gttggcatggctgctgtg 426


 gi|4318818|gb|AI464788|AI464788 mz80h09.y1 Soares mouse NML Mus musculus cDNA clone IMAGE:719777 5'
           similar to TR:P97524 P97524 VERY-LONG-CHAIN ACYL-COA
           SYNTHETASE. ;, mRNA sequence [Mus musculus]
           Length = 360
           
 Score = 36.2 bits (18), Expect = 3.0
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 492 gttggcatggctgctgtg 509
           ||||||||||||||||||
Sbjct: 337 gttggcatggctgctgtg 354


CPU time:     0.15 user secs.	    0.03 sys. secs	    0.18 total secs.

  Database: Non-redundant Database of GenBank Mouse EST entries
    Posted date:  Oct 8, 1999  6:07 PM
  Number of letters in database: 261,636,151
  Number of sequences in database:  695,905
  
Lambda     K      H
    1.37    0.711     0.00 

Gapped
Lambda     K      H
    1.37    0.711 4.94e-324 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 96581
Number of Sequences: 695905
Number of extensions: 96581
Number of successful extensions: 7206
Number of sequences better than 10.0: 17
length of query: 956
length of database: 261,636,151
effective HSP length: 19
effective length of query: 937
effective length of database: 248,413,956
effective search space: 232763876772
effective search space used: 232763876772
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 25 (49.6 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)