pgwise 2.0.4b (Mon Mar 16 18:05:46 1998 release)
This program is freely distributed under a GPL. See source directory
Copyright (c) GRL limited: portions of the code are from separate copyright

Query protein:       |A.oryzae|
Comp Matrix:         blosum62.bla
Gap open:            12
Gap extension:       2
Start/End            local
Target Sequence      thyroidrb,
Strand:              forward
Gene Paras:          human.gf
Codon Table:         codon.table
Subs error:          1e-05
Indel error:         1e-05
Model splice?        model
Model codon bias?    flat
Model intron bias?   tied
Null model           syn
Algorithm            623

pgwise output
Score 16.93 bits over entire alignment
Scores as bits over a synchronous coding model

Warning: The bits scores is not probablistically correct for single seqs
See WWW help for more info

|A.oryzae|        58 GGKGVLKAVENVNKTIAPAV                              
                     GGK  L+A  +  K I PA+                              
                     GGKVDLEAFSHFTKIITPAI                              
thyroidrb,       775 ggaggcggtactaaaaacga                              
                     ggatatactgatcattccct                              
                     tagccgaccctcaaccaagt                              


//