BCM Search Launcher query sequence

956 base pairs

Graphic map | Table by enzyme name | Table by site position



SfcI
gatcttctggtcgttgaaacattgatgtctctgtagcaacataggggtaatcttactgacaacagatagttaccc base pairs
ctagaagaccagcaactttgtaactacagagacatcgttgtatccccattagaatgactgttgtctatcaatggg 1 to 75
BstSFI






gtcattatgcaatttaatatccctacgttgcttacactgttccgtgtcatccttatcccattctttgtattggtc base pairs
cagtaatacgttaaattatagggatgcaacgaatgtgacaaggcacagtaggaatagggtaagaaacataaccag 76 to 150






SexAI
ttttatctgcctgtcacctggtcgccgtttgccgccgcgctcattttctgcgtcgcggcggtgactgactggttc base pairs
aaaatagacggacagtggaccagcggcaaacggcggcgcgagtaaaagacgcagcgccgccactgactgaccaag 151 to 225






NspBII
gatggttttctggcacgccgctggaaccagagtacccggtttggtgctttccttgaccctgtggcagataaagtt base pairs
ctaccaaaagaccgtgcggcgaccttggtctcatgggccaaaccacgaaaggaactgggacaccgtctatttcaa 226 to 300
MspA1I



NcoI Bsp19I PspEI
StyI DsaI BstEII MspA1I Bse118I
BsiI Eco130I Eco91I PvuII BssAI
ctcgtggctatcgccatggtgctggtaaccgagcattatcacagctggtgggtgacattaccggcggcaacgatg base pairs
gagcaccgatagcggtaccacgaccattggctcgtaatagtgtcgaccacccactgtaatggccgccgttgctac 301 to 375
BssSI ErhI BstDSI EcoO65I NspBII BsrFI
BssT1I BstXI Cfr10I
EcoT14I BstPI



EaeI
atcgcccgtgaaattattatttctgcgctacgcgaatggatggcggagttgggtaaacgcagtagcgtggccgtc base pairs
tagcgggcactttaataataaagacgcgatgcgcttacctaccgcctcaacccatttgcgtcatcgcaccggcag 376 to 450
CfrI



BsaHI
Esp1396I BbiII
BsmBI XcmI AccB7I Hin1I
tcctggattgggaaagtgaaaaccactgcccagatggtggcgttggcatggctgctgtggcgtccgaacatttgg base pairs
aggacctaaccctttcacttttggtgacgggtctaccaccgcaaccgtaccgacgacaccgcaggcttgtaaacc 451 to 525
Esp3I PflMI Msp17I
Van91I Hsp92I
AcyI


Bse118I
BssAI DrdI SspI
gttgagtacgccggtattgcacttttctttgtggctgcggtactgactctgtggtcaatgttgcaatatttgagc base pairs
caactcatgcggccataacgtgaaaagaaacaccgacgccatgactgagacaccagttacaacgttataaactcg 526 to 600
BsrFI
Cfr10I


HaeII
AfeI Ksp22I
Aor51HI BsgI FbaI
gctgcgcgtgcagatttgcttgatcagtgatcgtttcggcgtaattttcagcaaacgatcaaaagtggtgaaaaa base pairs
cgacgcgcacgtctaaacgaactagtcactagcaaagccgcattaaaagtcgtttgctagttttcaccacttttt 601 to 675
Eco47III BclI
Bsp143II
BstH2I


BsaMI
HincII BsmI
tatcgttgactcatcgcgccaggtaagtagaatgcaacgcatcgaacggcggcactgattgccagacgataataa base pairs
atagcaactgagtagcgcggtccattcatcttacgttgcgtagcttgccgccgtgactaacggtctgctattatt 676 to 750
HindII Mva1269I



BssT1I
BsaMI Alw21I ErhI
BsmI AspHI EcoNI
aatcaagtgattaactgattgcttgatgaatgcgggaatagctcagttggtagagcacgaccttgccaaggtcgg base pairs
ttagttcactaattgactaacgaactacttacgcccttatcgagtcaaccatctcgtgctggaacggttccagcc 751 to 825
Mva1269I Bbv12I Eco130I
BsiHKAI StyI
EcoT14I

BpmI Hsp92I SseBI
BstD102I Msp17I AatI
Bsp68I AccBSI DrdI AcyI Pme55I
ggtcgcgagttcgagtctcgtttcccgctccagtttaaaagacatcggcgtcaagcggatgtctggctgaaaggc base pairs
ccagcgctcaagctcagagcaaagggcgaggtcaaattttctgtagccgcagttcgcctacagaccgactttccg 826 to 900
NruI BsrBI DraI Hin1I StuI
GsuI BbiII Eco147I
BsaHI


ApoI HindII
Eco57I HpaI
ctgaagaatttggcgcgttaacaaagcggttatgtagcggattgcaaatccgtcta base pairs
gacttcttaaaccgcgcaattgtttcgccaatacatcgcctaacgtttaggcagat 901 to 956
AcsI HincII




Table by Enzyme Name


Enzyme No. Positions Recognition
name cuts of sites sequence
AatI 1 899 agg/cct More info< AccB7I 1 486 ccannnn/ntgg More inf AccBSI 1 855 gagcgg More inf AcsI 1 906 r/aatty More info< AcyI 2 510 873 gr/cgyc More info< AfeI 1 600 agc/gct More info< Alw21I 1 807 gwgcw/c More inf Aor51HI 1 600 agc/gct More in ApoI 1 906 r/aatty More info< AspHI 1 807 gwgcw/c More info BbiII 2 510 873 gr/cgyc More info Bbv12I 1 807 gwgcw/c More inf BclI 1 621 t/gatca More info< BpmI 1 858 ctggag More info< BsaHI 2 510 873 gr/cgyc More info BsaMI 2 710 783 gaatgc More info Bse118I 2 360 535 r/ccggy More in BsgI 1 613 gtgcag More info< BsiHKAI 1 807 gwgcw/c More in BsiI 1 306 ctcgtg More info< BsmBI 1 452 cgtctc More info BsmI 2 710 783 gaatgc More info< Bsp143II 1 602 rgcgc/y More i Bsp19I 1 314 c/catgg More inf Bsp68I 1 830 tcg/cga More inf BsrBI 1 855 gagcgg More info BsrFI 2 360 535 r/ccggy More info BssAI 2 360 535 r/ccggy More info BssSI 1 306 ctcgtg More info BssT1I 2 314 816 c/cwwgg More inf BstD102I 1 855 gagcgg More i BstDSI 1 314 c/crygg More inf BstEII 1 324 g/gtnacc More inf BstH2I 1 602 rgcgc/y More inf BstPI 1 324 g/gtnacc More info BstSFI 1 31 c/tryag More inf BstXI 1 321 ccannnnn/ntgg More info Cfr10I 2 360 535 r/ccggy More inf CfrI 1 443 y/ggccr More info< DraI 1 861 ttt/aaa More info< DrdI 2 576 872 gacnnnn/nngtc More info< DsaI 1 314 c/crygg More info< EaeI 1 443 y/ggccr More info< Eco130I 2 314 816 c/cwwgg More in Eco147I 1 899 agg/cct More in Eco47III 1 600 agc/gct More i Eco57I 1 906 ctgaag More inf Eco91I 1 324 g/gtnacc More inf EcoNI 1 815 cctnn/nnnagg More info EcoO65I 1 324 g/gtnacc More in EcoT14I 2 314 816 c/cwwgg More in ErhI 2 314 816 c/cwwgg More info< Esp1396I 1 486 ccannnn/ntgg More i Esp3I 1 452 cgtctc More info FbaI 1 621 t/gatca More info< GsuI 1 858 ctggag More info< HaeII 1 602 rgcgc/y More info Hin1I 2 510 873 gr/cgyc More info HincII 2 682 919 gty/rac More inf HindII 2 682 919 gty/rac More inf HpaI 1 919 gtt/aac More info< Hsp92I 2 510 873 gr/cgyc More inf Ksp22I 1 621 t/gatca More inf Msp17I 2 510 873 gr/cgyc More inf MspA1I 2 245 344 cmg/ckg More inf Mva1269I 2 710 783 gaatgc More i NcoI 1 314 c/catgg More info< NruI 1 830 tcg/cga More info< NspBII 2 245 344 cmg/ckg More inf PflMI 1 486 ccannnn/ntgg More info Pme55I 1 899 agg/cct More inf PspEI 1 324 g/gtnacc More info PvuII 1 344 cag/ctg More info SexAI 1 166 a/ccwggt More info SfcI 1 31 c/tryag More info< SseBI 1 899 agg/cct More info SspI 1 592 aat/att More info< StuI 1 899 agg/cct More info< StyI 2 314 816 c/cwwgg More info< Van91I 1 486 ccannnn/ntgg More inf XcmI 1 480 ccannnnn/nnnntgg More info<
The following endonucleases were selected but don't cut this sequence:

AatII, Acc113I, Acc16I, Acc65I, AccB1I, AccI, AccIII, AclNI, AflII, AflIII,
AgeI, AhdI, Alw44I, AlwNI, Ama87I, AocI, ApaI, ApaLI, AscI, AseI, AsnI,
Asp700I, Asp718I, AspEI, AspI, AtsI, AvaI, AviII, AvrII, BalI, BamHI, BanI,
BanII, BanIII, BbeI, BbrPI, BbsI, BbuI, Bbv16II, BcgI, BcoI, BfrI, BglI,
BglII, BlnI, BlpI, BpiI, Bpu1102I, Bpu14I, BpuAI, Bsa29I, BsaAI, BsaBI,
BsaI, BsaOI, BsaWI, BscI, Bse21I, Bse8I, BseAI, BseCI, BsePI, BseRI, Bsh1285I,
Bsh1365I, BshNI, BsiEI, BsiMI, BsiWI, BsoBI, Bsp106I, Bsp119I, Bsp120I,
Bsp13I, Bsp1407I, Bsp1720I, BspCI, BspDI, BspEI, BspHI, BspLU11I, BspMI,
BspTI, BspXI, BsrBRI, BsrDI, BsrGI, BssHII, Bst1107I, Bst98I, BstBI, BstI,
BstMCI, BstSNI, BstX2I, BstYI, BstZI, Bsu15I, Bsu36I, CciNI, CelII, Cfr42I,
Cfr9I, ClaI, CpoI, Csp45I, CspI, CvnI, DraII, DraIII, EagI, Eam1104I, Eam1105I,
EarI, Ecl136II, EclHKI, EclXI, Eco105I, Eco24I, Eco255I, Eco31I, Eco32I,
Eco52I, Eco64I, Eco72I, Eco81I, Eco88I, EcoICRI, EcoO109I, EcoRI, EcoRV,
EcoT22I, EheI, FauNDI, FriOI, FseI, FspI, HindIII, KasI, Kpn2I, KpnI, Ksp632I,
KspI, LspI, MamI, MfeI, MflI, MluI, MluNI, Mph1103I, MroI, MroNI, MscI,
MslI, MspCI, MunI, NaeI, NarI, NdeI, NgoAIV, NgoMI, NheI, NotI, NsiI, NspI,
NspV, PacI, PaeI, PaeR7I, Pfl23II, PinAI, Ple19I, PmaCI, PmeI, PmlI, Ppu10I,
PpuMI, PshAI, PshBI, Psp124BI, Psp1406I, Psp5II, PspAI, PspALI, PspLI,
PspOMI, PstI, PstNHI, PvuI, RcaI, RsrII, SacI, SacII, SalI, SapI, SbfI,
ScaI, SfiI, Sfr274I, Sfr303I, SfuI, SgfI, SgrAI, SmaI, SmiI, SnaBI, SpeI,
SphI, SplI, SrfI, Sse8387I, SspBI, SstI, SstII, SunI, SwaI, Tth111I, Vha464I,
VneI, VspI, XbaI, XhoI, XhoII, XmaI, XmaIII, XmnI, Zsp2I


Table by Site Position


Cut Enzyme No. Positions Recognition
site name cuts of other sites sequence
31 SfcI 1 c/tryag
More info 31 BstSFI 1 c/tryag More info 166 SexAI 1 a/ccwggt More info 245 NspBII 2 344 cmg/ckg More info 245 MspA1I 2 344 cmg/ckg More info 306 BsiI 1 ctcgtg More info 306 BssSI 1 ctcgtg More info 314 Eco130I 2 816 c/cwwgg More info 314 ErhI 2 816 c/cwwgg More info 314 StyI 2 816 c/cwwgg More info 314 BssT1I 2 816 c/cwwgg More info 314 NcoI 1 c/catgg More info 314 EcoT14I 2 816 c/cwwgg More info 314 BstDSI 1 c/crygg More info 314 DsaI 1 c/crygg More info 314 Bsp19I 1 c/catgg More info 321 BstXI 1 ccannnnn/ntgg More info 324 Eco91I 1 g/gtnacc More info 324 BstEII 1 g/gtnacc More info 324 BstPI 1 g/gtnacc More info 324 EcoO65I 1 g/gtnacc More info 324 PspEI 1 g/gtnacc More info 344 PvuII 1 cag/ctg More info 344 NspBII 2 245 cmg/ckg More info 344 MspA1I 2 245 cmg/ckg More info 360 BssAI 2 535 r/ccggy More info 360 BsrFI 2 535 r/ccggy More info 360 Bse118I 2 535 r/ccggy More info 360 Cfr10I 2 535 r/ccggy More info 443 EaeI 1 y/ggccr More info 443 CfrI 1 y/ggccr More info 452 BsmBI 1 cgtctc More info 452 Esp3I 1 cgtctc More info 480 XcmI 1 ccannnnn/nnnntgg More info 486 AccB7I 1 ccannnn/ntgg More info 486 PflMI 1 ccannnn/ntgg More info 486 Esp1396I 1 ccannnn/ntgg More info 486 Van91I 1 ccannnn/ntgg More info 510 Hin1I 2 873 gr/cgyc More info 510 Msp17I 2 873 gr/cgyc More info 510 BbiII 2 873 gr/cgyc More info 510 Hsp92I 2 873 gr/cgyc More info 510 BsaHI 2 873 gr/cgyc More info 510 AcyI 2 873 gr/cgyc More info 535 BssAI 2 360 r/ccggy More info 535 BsrFI 2 360 r/ccggy More info 535 Bse118I 2 360 r/ccggy More info 535 Cfr10I 2 360 r/ccggy More info 576 DrdI 2 872 gacnnnn/nngtc More info 592 SspI 1 aat/att More info 600 Aor51HI 1 agc/gct More info 600 Eco47III 1 agc/gct More info 600 AfeI 1 agc/gct More info 602 Bsp143II 1 rgcgc/y More info 602 HaeII 1 rgcgc/y More info 602 BstH2I 1 rgcgc/y More info 613 BsgI 1 gtgcag More info 621 FbaI 1 t/gatca More info 621 BclI 1 t/gatca More info 621 Ksp22I 1 t/gatca More info 682 HincII 2 919 gty/rac More info 682 HindII 2 919 gty/rac More info 710 BsmI 2 783 gaatgc More info 710 Mva1269I 2 783 gaatgc More info 710 BsaMI 2 783 gaatgc More info 783 BsmI 2 710 gaatgc More info 783 Mva1269I 2 710 gaatgc More info 783 BsaMI 2 710 gaatgc More info 807 AspHI 1 gwgcw/c More info 807 Bbv12I 1 gwgcw/c More info 807 Alw21I 1 gwgcw/c More info 807 BsiHKAI 1 gwgcw/c More info 815 EcoNI 1 cctnn/nnnagg More info 816 Eco130I 2 314 c/cwwgg More info 816 ErhI 2 314 c/cwwgg More info 816 StyI 2 314 c/cwwgg More info 816 BssT1I 2 314 c/cwwgg More info 816 EcoT14I 2 314 c/cwwgg More info 830 Bsp68I 1 tcg/cga More info 830 NruI 1 tcg/cga More info 855 AccBSI 1 gagcgg More info 855 BsrBI 1 gagcgg More info 855 BstD102I 1 gagcgg More info 858 GsuI 1 ctggag More info 858 BpmI 1 ctggag More info 861 DraI 1 ttt/aaa More info 872 DrdI 2 576 gacnnnn/nngtc More info 873 Hin1I 2 510 gr/cgyc More info 873 Msp17I 2 510 gr/cgyc More info 873 BbiII 2 510 gr/cgyc More info 873 Hsp92I 2 510 gr/cgyc More info 873 BsaHI 2 510 gr/cgyc More info 873 AcyI 2 510 gr/cgyc More info 899 Pme55I 1 agg/cct More info 899 StuI 1 agg/cct More info 899 AatI 1 agg/cct More info 899 Eco147I 1 agg/cct More info 899 SseBI 1 agg/cct More info 906 Eco57I 1 ctgaag More info 906 AcsI 1 r/aatty More info 906 ApoI 1 r/aatty More info 919 HpaI 1 gtt/aac More info 919 HincII 2 682 gty/rac More info 919 HindII 2 682 gty/rac More info

.
BCM HGSC